SARS-CoV-2 LAMP Primer Mix (N/E)

Catalog # Concentration Size List Price Quantity Your Price
S1883S 10 X 85 reactions $290.00
$261.00
Catalog # Size List Price Your Price
S1883S 85 reactions $290.00
$261.00
Catalog #
Qty:
 
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
  • What is the impact of the latest SARS-CoV-2 variant on this primer set? View the Primer Monitor Tool (more info here) for up-to-date information on variants mapped against common primer sets
  • Provided at 10X concentration
  • Targets N and E gene regions of SARS-CoV-2 genome
  • Optimized mixture of 2 primer sets for enhanced speed and sensitivity of SARS-CoV-2 viral RNA detection
  • Component of the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019)
  • Information on using this product to detect SARS-CoV-2 viral RNA using WarmStart LAMP reagents with UDG can be viewed here
  • Need assistance designing your own LAMP primers? Use the NEB LAMP Primer Design Tool
  • Learn more about LAMP and other isothermal amplification methods
  • A publication by members of the global LAMP (gLAMP) Consortium provides a comprehensive review of LAMP and its role in the COVID-19 pandemic
 
Featured Videos
View Video Library

The SARS-CoV-2 LAMP Primer Mix (N/E) is a dual-target primer mix that recognizes the nucleocapsid (N) and envelope (E) regions of the SARS-CoV-2 genome. It contains 2 sets of LAMP primers (F3, B3, FIP, BIP, LF, LB) for the enhanced detection of SARS-CoV-2 nucleic acid.

SARS-CoV-2 LAMP Primer Sequences (5´→ 3´)

Gene E1 Primer Set Sequence
E1-F3 TGAGTACGAACTTATGTACTCAT
E1-B3 TTCAGATTTTTAACACGAGAGT
E1-FIP ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG
E1-BIP TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT
E1-LF CGCTATTAACTATTAACG
E1-LB GCGCTTCGATTGTGTGCGT

 

Gene N2 Primer Set Sequence
N2-F3 ACCAGGAACTAATCAGACAAG
N2-B3 GACTTGATCTTTGAAATTTGGATCT
N2-FIP TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC
N2-BIP CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA
N2-LF GGGGGCAAATTGTGCAATTTG
N2-LB CTTCGGGAACGTGGTTGACC
Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration
  SARS-CoV-2 LAMP Primer Mix (N/E) S1883AVIAL -20 1 x 0.22 ml 10 X
Features
  • Optimized mixture of 2 primer sets for enhanced speed and sensitivity of SARS-CoV-2 viral RNA detection
  • Information on using this product to detect SARS-CoV-2 viral RNA using WarmStart LAMP reagents with UDG can be viewed here
  • View the protocol for recommended reaction setup

 

An exception occurred during the operation, making the result invalid. Check InnerException for exception details.

Quality Control Assay
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Top