We are transitioning to our new website at www.neb.com, which will go live on April 7th, 2025.
On April 2nd at 8:00 PM ET, www.neb.ca e-commerce functionality will be disabled for the website transition. If you need to place your order between April 2nd at 8:00 pm ET to April 6th, then please call 1-800-387-1095 or email orders.ca@neb.com.
The transition to the new website will not affect our shipping schedule. If you're a registered user, all your account details, including order history and shipping details will be safely transferred to the new site.The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a primer set (F3, B3, FIP, BIP, LF, LB) that amplifies rActin and can be used to confirm the activity of reagents, proper sample handling and the presence of human nucleic acid template in a LAMP reaction.
This product serves as an internal control primer set in the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019).
Control LAMP Primer Sequences: rActin (5´→ 3´)
rActin Primer Set | Sequence |
---|---|
ACTB-F3 | AGTACCCCATCGAGCACG |
ACTB-B3 | AGCCTGGATAGCAACGTACA |
ACTB-FIP | GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA |
ACTB-BIP | CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC |
ACTB-LF | TGTGGTGCCAGATTTTCTCCA |
ACTB-LB | CGAGAAGATGACCCAGATCATGT |
Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.