PI-SceI

Catalog # Concentration Size List Price Quantity Your Price
R0696S 5000 units/ml 250 units $119.00
$107.10
Catalog # Size List Price Your Price
R0696S 250 units $119.00
$107.10
Catalog #
Qty:
 
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG (-22/-26)
Featured Videos
View Video Library
The intein encoding PI-SceI is present in the VMA ATPase gene Saccharomyces cerevisiae (1,5). The gene has been modified for independent expression in E. coli using a T7 RNA polymerase expression system (2).
Product Source
An E. coli strain that carries the VMA1 ATPase gene from Saccharomyces cerevisiae (J. Thorner).
Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration
  PI-SceI R0696SVIAL -20 1 x 0.05 ml 5,000 units/ml
  NEBuffer™ PI-SceI B0696SVIAL -20 1 x 1.5 ml 10 X
  Recombinant Albumin, Molecular Biology Grade B9200SVIAL -20 1 x 0.6 ml 20 mg/ml
  pBSvdeX XmnI-linearized Control Plasmid N0422SVIAL -20 1 x 0.01 ml 0.5 mg/ml

Properties & Usage

Unit Definition

One unit is defined as the amount of enzyme required to cleave 1 μg of pBSvdeX XmnI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 μl.

Reaction Conditions

1X NEBuffer™ PI-SceI
Supplement with Recombinant Albumin, Molecular Biology Grade
Incubate at 37°C

1X NEBuffer™ PI-SceI
10 mM MgCl2
1 mM DTT
10 mM Tris-HCl
100 mM KCl
(pH 8.6 @ 25°C)

Activity in NEBuffers

NEBufferâ„¢ r1.1: 10%
NEBufferâ„¢ r2.1: 10%
NEBufferâ„¢ r3.1: 10%
rCutSmartâ„¢ Buffer: 10%

Diluent Compatibility

Storage Buffer

10 mM Tris-HCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
300 mM NaCl
pH 7.4 @ 25°C

Heat Inactivation

65°C for 20 minutes

Materials Sold Separately
Notes
  • Supplied with plasmid DNA: XmnI-linearized pBSvdeX is supplied 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.7 kb plasmid with PI-SceI gives fragments of 2550 and 1150 base pairs Enzyme Properties
  • Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  • PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
  • Supplement with supplied vial of Recombinant Albumin (rAlbumin) to 100 µg/ml.
Tech Tips
  • PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
Quality Control Assay
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Top