EnGen^® sgRNA Synthesis Kit, S. pyogenes Protocol (NEB #E3322)

1. Select 20 nucleotide target sequence (not including the PAM (NGG) sequence). Use of a target DNA selection program is recommended. We recommend ChopChop.
2. Check input sequence for presence of "G" at the 5´ end. If there are no "G's" at the 5´ end, add one "G" (making it a total of at least one G at the 5´ end).
3. To the 5´ end; append T7 promoter sequence: TTCTAATACGACTCACTATA
4. To the 3´ end; append 14 nucleotide overlap sequence: GTTTTAGAGCTAGA
5. Check complete oligo sequence: 5´ TTCTAATACGACTCACTATAG(N)₂₀GTTTTAGAGCTAGA 3´

Example

1. Thaw EnGen 2X sgRNA Reaction Mix, S. pyogenes, 0.1 M DTT and customer-supplied target-specific oligo (1 µM). Mix and pulse-spin each component in a microfuge prior to use. Store enzyme mix on ice but assemble reaction at room temperature.
2. Assemble the reaction at room temperature in the order listed. Avoid master mixes, and add the enzyme last to each reaction:
   

   REAGENT	AMOUNT
   Nuclease-free water	2 μl
   EnGen 2X sgRNA Reaction Mix, S. pyogenes	10 μl
   Target-specific DNA Oligo (1 µM)	5 μl
   DTT (0.1 M)	1 μl
   EnGen sgRNA Enzyme Mix	2 μl
   Total volume	20 μl

   
   
   
3. Mix thoroughly and pulse-spin in a microfuge. Incubate at 37°C for 30 minutes.
4. Transfer reaction to ice.
5. For DNase treatment bring volume to 50 μl by adding 30 μl of nuclease-free water. Add 2 μl of DNase I (RNase-free, provided), mix and incubate at 37°C for 15 minutes.
6. Proceed with purification of RNA or analysis by gel electrophoresis.

NOTE: sgRNAs synthesized using in vitro transcription methods from a DNA template and a bacteriophage polymerase will possess a 5´ triphosphate.

Optional: To remove the 5´ triphosphate (leaving a 5´ OH), treatment of the sgRNA with Quick CIP (NEB #M0525) can be performed. Phenol:chloroform extraction and/or cleanup by spin column is recommended to inactivate and remove the phosphatase.

Purification of sgRNAs
Spin columns will remove proteins, salts and most unincorporated nucleotides. Please ensure that spin columns are compatible with the size of sgRNAs (~100 nts) and expected RNA yields (4–25 µg). Follow manufacturer’s instructions. We recommend Monarch RNA Cleanup Kit (50 μg) (NEB #T2040) for purification .

Evaluation of sgRNA transcription products
Quantitation by UV Light Absorbance
sgRNA concentration following purification can be determined by measuring absorbance at 260 nm on a standard UV spectrophotometer following dilution of the sample, or read directly on a NanoDrop^® (recommended). 1 OD₂₆₀ unit for single-stranded RNA (ssRNA) is 40 µg/ml. RNA concentration can be determined as follows:
    A₂₆₀ x dilution factor x 40 = "x" µg/ml ssRNA.
Expected yields following purification can be 4–25 µg.

Figure 4: Range of sgRNA yield from the EnGen sgRNA Synthesis Kit, S. pyogenes.

1. Assessment of sgRNA quality and length can be evaluated by gel electrophoresis. Gels should be run under denaturing conditions to avoid formation of secondary structure.  
2. Mix an aliquot of RNA with RNA Loading Dye, (2X) (NEB #B0363) or Urea Dye.  
3. Denature RNA according to manufacturer’s recommendation and load onto a TBE-urea gel, such as Novex^® TBE-urea gels.
4. Visualize RNA by staining the gel with SYBR^® Gold or ethidium bromide.

Figure 5: Examples of sgRNAs synthesized using the EnGen sgRNA Synthesis Kit, S. pyogenes and multiple different target-specific oligos including the EnGen sgRNA Control Oligo, S. pyogenes.

Figure 6: Example of an in vitro Cas9 nuclease assay.