microRNA Marker

Catalog #	Concentration	Size	List Price	Quantity	Your Price
N2102S	12 ng/µl	100 gel lanes	$119.00		$107.10

Catalog #	Size	List Price	Your Price
N2102S	100 gel lanes	$119.00	$107.10

The microRNA Marker is a set of three synthetic single-stranded RNA oligonucleotides 17, 21 and 25 residues long that have free 5´ ends (i.e., no 5´ phosphate groups). These oligonucleotides can be used as size markers on denaturing polyacrylamide gels and Northern blots. The microRNA Marker is best visualized by staining with SYBR-Gold instead of ethidium bromide (Figure 1).

The three marker oligos contain the same core sequence so they can be detected by hybridization with the same probe. The sequences of the microRNA marker band are as follows:

25-mer: 5´AGAGCAGUGGCUGGUUGAGAUUUAA 3´
21-mer: 5´AGCAGUGGCUGGUUGAGAUUU 3´
17-mer: 5´CAGUGGCUGGUUGAGAU 3´

Note: The sequence in bold is common to all three oligos.

A 21-mer DNA oligonucleotide complementary to the marker sequences is included. This oligonucleotide is biotinylated at the 3´ end and has a free 5´ end so it can also be labeled with γ-³²P-ATP and T4 Polynucleotide Kinase (NEB# M0201). The sequence of the oligonucleotide probe is as follows:

5´AAATCTCAACCAGCCACTGCT 3´-Biotin

The microRNA Marker is provided in a ready-to-load solution containing 4M urea and 0.04% Orange-G. The microRNA Marker Probe is resuspended in water.

Reagents Supplied

The following reagents are supplied with this product:

NEB #

Component Name

Component #

Stored at (°C)

Amount

Concentration

N2102S -20

	microRNA Marker	N2102SVIAL	-20	1 x 0.5 ml	12 ng/µl
	MicroRNA Marker Probe (21-mer)	S1328SVIAL	-20	1 x 0.5 ml	20 ng/µl

Properties & Usage

Companion Products

Notes

The microRNA Marker is provided in a ready-to-load denaturing solution. Denature by heating for 3-5 minutes at 95°C and place on ice. Load 5-10 µl for staining with SYBR Gold in denaturing gels. In Northern blots, less than 1 µl (12 ng) is sufficient for detection by hybridization.

The Orange G loading buffer migrates faster than the smallest band, and migrates approximately as far as the nucleotides.
Oligonucleotide Probe Usage: The provided biotinylated probe DNA oligonucleotide can be labeled with T4 Polynucleotide Kinase (NEB #M0201) and radioactive γ-³²P-ATP using the following protocol:

1. Mix the following components in a sterile microfuge tube:

Oligonucleotide Probe -- 1-5 µl
10X T4 Polynucleotide Kinase reaction Buffer -- 2.0 µl
γ-³²P-ATP (5 µCi/µl) -- 1-2 µl
T4 Polynuclotide Kinase -- 1 µl
Sterile dH₂0 -- X µl
Total volume -- 20 µl

2. Incubate for 30 minutes at 37°C.

3. Purify labeled probe using a G-25 spin column.

References

Sambrook, J. and Russel, D.W. (2001). Molecular Cloning: A Laboratory Manual (3rd Ed.). 7.1-7.56.

FAQs

Citations

See more details on Bioz

Quality Control Assay

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

N2102S_v1

Certificate of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety Data Sheets

microRNA Marker

Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.