In vitro digestion of DNA with EnGen^® Seq1 Cas9 (NEB #M0668)

Overview

EnGen Seq1 Cas9 is a double-stranded DNA endonuclease guided to its target by sequence complementarity of a small RNA loaded into the protein. This protocol describes how to digest double-stranded DNA in vitro using EnGen Seq1 Cas9 and a single guide RNA (sgRNA). 

Required Materials:

• EnGen Seq1 Cas9 (NEB #M0668)
  
  
• 10X NEBuffer r3.1
  
  
• Nuclease-free water
  
  
• Proteinase K, Molecular Biology Grade (NEB #P8107)
  
  
• sgRNA encoding sequence complementarity to the target DNA
  
  
  • sgRNAs can be generated by in vitro transcription using the HiScribe T7 Quick High-Yield RNA Synthesis Kit (NEB #E2050)
    
    
  • Custom synthetic sgRNAs can be purchased from multiple vendors
    
    5’‑ NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUGUGUUGGAAACAACACAGCGAGUUA
    AAAUAAGGCUUUGUCCGUACACAACUUGUAAAAGUGGCACCCGAUUCGGGUGCAUUUUUU -3’
    
    The underlined 20-nucleotide spacer sequence is specific to the desired DNA target region immediately upstream of the 5’-NAGA-3’ protospacer adjacent motif. The spacer sequence does not contain the PAM sequence itself. The portion of the sgRNA not underlined is the scaffold specific for ribonucleoprotein complex formation with EnGen Seq1 Cas9.
    
    
• DNA substrate containing the target sequence
  
  
  • The substrate DNA can be circular or linearized plasmid, PCR products, or synthesized oligonucleotides.
    
    

Optional Materials:

• Apparatus and reagents for DNA fragment analysis
  
  
  • E.g., Agarose gel electrophoresis apparatus
    
    
    • DNA Loading Dye (e.g., Gel Loading Dye, Purple (6X) (NEB #B7024S))
      
      
  • E.g., Agilent Bioanalyzer or similar
    
    

Before You Start:

• We strongly recommend wearing gloves and using nuclease-free tubes and reagents to avoid RNase contamination. Further recommendations for avoiding ribonuclease contamination can be found here.
  
  
• Reactions are typically 30 μl but can be scaled up as needed. Reactions should be assembled in nuclease-free microfuge tubes or PCR strip tubes.
  
  
• It is essential to keep the molar ratio of EnGen Seq1 Cas9 and sgRNA per target site at 10:10:1 or higher to obtain the best cleavage efficiency. A calculator can be found here.
  
  
• Prepare 300 nM sgRNA by diluting the stock with nuclease-free water on ice.
  
  
• Prepare 30 nM substrate DNA with a single target sequence by diluting the stock with nuclease-free water on ice.
  
  
• Prepare 1 µM EnGen Seq1 Cas9 by diluting the enzyme stock (NEB #M0668T) with 1X NEBuffer r3.1 (NEB # B6003S) for immediate use.
  
  

Procedure

1. Assemble the reaction at room temperature in the following order.
   
   

   COMPONENTS	µl/ RXN	FINAL CONC. (nM)
   Nuclease-free water	20
   10X NEBuffer r3.1	3
   300 nM sgRNA	3	30
   1 µM EnGen Seq1 Cas9	1	30
   Reaction volume	27
   Pre-incubate for 10 minutes at 25⁰C
   30 nM substrate DNA	3	3
   Total reaction volume	30

   *The substrate DNA, sgRNA, and nuclease-free water are not included.
   
   

2. Mix thoroughly and pulse-spin in a microfuge.
   
   
3. Incubate at 37°C for 15 minutes.
   
   
4. Add 1 µl of Proteinase K to each sample, mix thoroughly and pulse-spin in a microfuge.
   
   
5. Incubate at room temperature for 10 minutes.
   
   
6. Proceed with analysis.