E-commerce functionality is temporarily disabled on neb.ca as we transition to our new website.

If you need to place an order, please call 1-800-387-1095 or email orders.ca@neb.com.

Regular functionality will return on Monday, April 7th at 8 am ET.

The transition to the new website will not affect our shipping schedule. If you're a registered user, all your account details, including order history and shipping details, will be safely transferred to the new site.

EpiMark® 5-hmC and 5-mC Analysis Kit

Catalog # Concentration Size List Price Your Price
E3317S 20 reactions
Catalog # Size List Price Your Price
E3317S 20 reactions
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca

The EpiMark® 5-hmC and 5-mC Analysis Kit can be used to analyze and quantitate 5-methylcytosine and 5-hydroxymethylcytosine within a specific locus. Complete conversion of 5-hmC to glucosylated 5-hmC in DNA by T4 β-glucosyltransferase (T4-BGT).

  • Discrimination between 5-mC and 5-hmC in CCGG sequences using enzymatic digestion and PCR amplification
  • Relative quantitation of 5-mC and 5-hmC
  • Easy-to-use protocol
  • This kit contains enough material for 20 reactions
5-methylcytosine (5-mC) is the predominant epigenetic mark in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a newly discovered epigenetic modification that is presumably generated by oxidation of 5-mC by the TET family of cytosine oxygenases.1,2

Techniques exist that can identify 5-mC in genomic DNA, but the most commonly used method, bisulfite sequencing, is laborious and cannot distinguish between 5-mC from 5-hmC.3 

The kit distinguishes 5-mC from 5-hmC by the addition of glucose to the hydroxyl group of 5-hmC via an enzymatic reaction utilizing T4 β-glucosyltransferase (T4-BGT). When 5-hmC occurs in the context of CCGG, this modification converts a cleavable MspI site to a noncleavable one.

An overview of the detection procedure is summarized in Figure 1.

Control DNA Sequence 
5´-CAGTGAAGTTGGCAGACTGAGCCAGGTCCCACAGATGCAGTGACCGGAGT
CATTGCCAAACTCTGCAGGAGAGCAAGGGCTGTCTATAGGTGGCAAGTCA-3´

Control DNA substrates are synthetic 100 bp double stranded fragments containing a single MspI/HpaII site (CCGG). The three fragments are identical except for modification of the internal C in this site.

FW Primer Sequence 
5´- CA GTG AAG TTG GCA GAC TGA GC -3´

REV Primer Sequence 
5´- CTG ACT TGC CAC CTA TAG ACA GC -3´


Companion Products
References
  • Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y., Agarwal, (2009). Science 324. 930-935, PubMedID: 19372391
  • Huang, Y, Pastor, W.A., Shen, Y., Tahiliani, M., Liu, D.R., Rao, A. (2010). PloS One. PubMedID: 20126651
  • Kriaucionis, S. and Heintz, N. (2009). Science 324. 929-930, Epub 2009 Apr 16.
Additional Citations
  • Kienhöfer S., Musheev M., Stapf U., Helm M., Schomacher L., Niehrs C., Schäfer A. (2015) GADD45a physically and functionally interacts with TET1Publication DifferentiationPubMedID: 26546041, DOI: 10.1016/j.diff.2015.10.003
  • Zhao C, Wang H, Zhao B, Li C, Yin R, Song M, Liu B, Liu Z, Jiang G (2014) Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine Nucleic Acids Res 42(9), e81.PubMedID: 24682822, DOI: 10.1093/nar/gku216
  • Chandra S, Baribault C, Lacey M, Ehrlich M (2014) Myogenic differential methylation: diverse associations with chromatin structure Biology (Basel) 3(2), 426-51.PubMedID: 24949935, DOI: 10.3390/biology3020426
Quality Control Assay
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.The purchase of this product conveys to the user the non-transferable right to use the purchased amount of product for Research Use Only. Commercial use of this product may require a license from New England Biolabs. Please contact busdev@neb.com for further details.

Top